Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14162D10
Clone ID IST14162D10
Vector VICTR74
Project tigm

Sequence tag IST14162D10HMF2
Sequence
GCTCTTCTGGGTTAAACCGAAGTCACCTAGTATCGAAGGGCAGATGTGTAACATGGTAAAACATGCTGTGCTGACAGAAG
TGTACAGCCTGGCACAGACAGTACTCATATGCTGAAGAGAAATCATTACTTGAGGTGCTCAGCACTGACTGAATTAAGAC
TCTTTAGCCTATTAAGACAATACCTACCAGAAGAGGTACAGAGAGCTTTTCTGACAGTAGAAAACTTCTGCGAACGACAG
AAGGCAGGAAGACATCCCACCTCGCCTTCAAGACCTACCTGAGCTCTCCTCAGGTCCCCTAGCACACGTTCTCAACAAGC
TATTATGATGCTACACATGCACTGATTGGCAGGAGGAAAGTGCTGGTCATGAGTGCTGGCAGGGGTCATCAATTACACAA
TCTTTTTTGTGTGCTGTTTGTCATCCTTACACAACTGAGTTTGCCTGACAAGTGTNACAAGGAGCATCCTTTTGTGGAAA
ATCNAATATACNCAACATTCCCAATCNAACCCAGGGCCTCTTANTCAAGANTCACTGTTNNNANNNATCTACATTANCNN
NCNC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180435584..180436139 532
 
EST/CDNA Est Name
  CA327345.1 - BQ771134.1 - BB664208.1 - BI653462.1 - BB637982.1 - BB636983.1 - CF167818.1 - CD538654.1 - CJ120189.1 - CJ124314.1 - AI549786.1 - CJ109437.1 - CJ113618.1 - CJ109373.1 - CJ107220.1 - CJ109245.1 - CJ110632.1 - CJ125781.1 - CJ127563.1 - AA427046


Sequence tag IST14162D10HMR1
Sequence
CAAAGATTCATGTTGCACTTAGATCCTTACATAGTGATCCGTGTTGTANAATCTGTTTCTTATGCTCAAGCCCCAACTAA
GAAATTGTTGCTGAGTGGAGTCTCCTTTAAGTCTTAGATGACTGGGTCCTTTATAGAAACCCAGTAGTCTCTGAGGTTTT
GTGTTGATTCGGTTACAAAGGTTGTGTGATTTGCAGCCAGTGATAGTGAGCTCTTTGGAAAGAGGAGGTCAAAGCCCANA
GTCTGANTTGTGCTCATTTGTTCTGAGTGTGCANGCTCGCCTGTGANACANANCATGTTC
Sequence Type genomic DNA
Unitrap ID UNI22601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180435286..180435584 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


Sequence tag IST14162D10BBF1
Sequence
CAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12672 UNI30731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308902 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418023 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030979..18031019 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580677..55580717 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849602 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042433..6042473 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]

 
Come back to gene ENSMUSG00000068270


For any suggestions or comments, please send an email to unitrap@crg.es