Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10732E11
Clone ID IST10732E11
Vector VICTR76
Project tigm

Sequence tag IST10732E11HMF1
Sequence
CTGGGAGTTTGCCAAGCTGCCCTGATGGTTTTAAAGTACAGCCAGCTATATGGATGGGTGCACACCANACAGGGTTAGGC
GGATCCATTTGAATTTGAAATCTTGAGGAAAACAGGGGACTGTCTCAAGGCCCCGGCACTGGCTGGTTGCAAGGCCTGAA
CCAGGATAAGGCGCCTGCAGTTCTAGCTGGTGTCATCACTCACCCCACCTCGTGGCCTGGAACGTTCTCCTTCCGAGCCT
CAGCTTGTACGTGCGTGTGTCNTGTGGGGGGTGGAGTCCACGTGCCACAGTGTATCTGTCAAGTCAGAGGACAGCTTTAT
GGAGCGGGTTCCCTCCTTCNACCTTTATATGGGCACCANGGATCAAATTCGGGTTTCCACGTTTATCCAGCAAGCTCTTT
CTCCTACTGAGCCATCTTGTTGGGATCCTCAGCCTTAGCCTTTTGANCCCAAACAAGAGCCTTGGTTGAGCCCGGTCCTG
AAACCNGCTTTGTACCTGGCCCACTCTACTCNGGANTNNNAACNNNCCATNCCCNNNAN

Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79457371..79457904 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es