Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635A7
Clone ID IST14635A7
Vector VICTR74
Project tigm

Sequence tag IST14635A7BBF2
Sequence
CTCATAAAAAGAAAATTATTTTCTTATAATTATAGCCAATATTTCTAATTACAATTTCAGCAGCAGCATCTCAGTCAGGT
CTGACAGCCAAACTATCTAACTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATATAAAGCCAGAG
CAAAAAGTTTCCCACACAGCTGGAAAGAGTATCCTGCTCTTGAANAGGACCAAGAGTTCANACCCTAACACCCATGGTGA
GTACTATAATTTGAGTTCTAACCTACTCCTGGCCCTCTTCTGGCCTGTGTAGGTACCTGCACTAACGCAAGCATGTACCC
CATATACACATGCATTTACACATAAGCNAAAGTAATGTATATATACNCACNCACACNCACACACACACACNCANATATAT
ATATATATATATATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35297061..35297474 398
NO GENE  


Sequence tag IST14635A7HMF3
Sequence
GTTTAAGTACACGTTTGAGAAGTGTCTANACACTTCAGCATTTAGAATGAAAAGAAAACAAAAAGAATACAGANATACAG
GCCAGAAATAGAGGCTAGGTCTACGTACTAAACTCTATTTCAAAGCAAAACAATAACATAAAGACTCAACCACTATCGTA
GGCCAAGCAGAAGAGGTTGTTTTAAGGAGGTTGGCTGAGGAAACTGGATTCGTTTCAATGTTTTCTTGTGCAGGGGACTT
CCTCATCATAGGATGTTC
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154998200..154998456 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]


Sequence tag IST14635A7HMR1
Sequence
ATGAGGACNATCTTCATTTAAAACTTAATATTTCCTTATTGCTCCCTTAATCTCAACTAGTTTATAGTGCAAAATTGAAG
ATGATAGGCTGGGATTTAGAGATTTAGTCAAATACAATTTGGTTTTCAGAGTGAGTTAATTATAAGGGTTATCCTTGTTT
TTTGGGCAGTTACCAAGAGATTTGGGAGCTGAGGTTCCTACAGCTGTGTTAANTCTGCTTAATGCANATACNACCTGGCA
CACCTATAACTGTATAGAGTAATTCACAATCCTGGATCCTGTGCACTGTGACAAGTTNATGTTGCTGTGAGTACTTTTAA
TTTCTAAATCTCCNCNGATTTGCATTTNAATGANCCATCCTANCATTTCNTTAACATAACCTTGCTGTTTAAAAAATTGG
CTTCGACTTGCATCCCAANGTTGGAAAANACNCNCTTTNNNNNTGATGTGACCNTTGTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es