Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14525H2
Clone ID IST14525H2
Vector VICTR74
Project tigm

Sequence tag IST14525H2HMR1
Sequence
CTCTGAGGTTCCTTGTTGAGGCTGTAGCAGTAACAGAACCCCACCTGAGCCCAGCTTCCCTGGGTCTGGCTTTTCTTCAG
CCCCTCACCTCCCTTAGCAGGGTTCCAGGGCCAAAGTCTAGCAGGATGTGGCATACATACATGCAGACAAAAACTTANAC
ACATGAAAATAAAATAAATCTTTAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84858049..84858242 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14525H2BBF1
Sequence
AGAGTGCTTATTAGGTACAGCATGGGGATTGGGGCTGTGTGGAGGATTAGCTAGTCTCAGTAGGAGGTCTCTGTGGGCAA
GCAGTCAGGTTGTAAACAAACAAGAGGAGGAAGCTACAGATGCTAGTTTTTGCACACACCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84857908..84858052 145
NO GENE  


Sequence tag IST14525H2HMF1
Sequence
AGAGTGCTTATTAGGTACAGCATGGGGATTGGGGCTGTGTGGAGGATTAGCTAGTCTCAGTAGGAGGTCTCTGTGGGCAA
GCAGTCAGGTTGTAAACAAACAAGAGGAGGAAGCTACAGATGCTAGTTTTTGCACACACCGGATCCATAAACACTCAAAC
TCCAACTCCAGANAAAAGTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84857868..84858052 183
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es