Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10341G12
Clone ID IST10341G12
Vector VICTR76
Project tigm

Sequence tag IST10341G12BBF1
Sequence
GTGTGGAATGTCATTCTGCCCTCANGCTTTTCCTGTGTGTGCTTTCCTCCAGTCCTCCCCTCAGGACCCTTTTCACGGCT
AGGATAACATCACTTCATTCATCCCATCTCTTTCTTTGCCTTGGGAGCATTTCAGAATCTTCATCTNANTTCGGTTTGGG
GGAGAAGGTANTAAGTAGATGAGTGGCTTTCTCTTCTTGCTGGTTGGTGCAATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56871830..56872047 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST10341G12HMF1
Sequence
GTGTGGAATGTCATTCTGCCCTCAGGCTTTTCCTGTGTGTGCTTTCCTCCAGTCCTCCCCTCAGGACCCTTTTCACGGCT
AGGATAACATCACTTCATTCATCCCATCTCTTTCTTTGCCTTGGGAGCATTTCAGAATCTTCATCTCAGTTCGGTTTGGG
GGAGAAGGTAA
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56871878..56872047 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es