Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15082C6
Clone ID IST15082C6
Vector VICTR80
Project tigm

Sequence tag IST15082C6HMF1
Sequence
CTCCACAGCTGCTCTTCTGCGGCCCTCCATGTTTTTAAGTAATCATATCTGAGAACACAGCATGGGGAAAAAAGTCCCAT
GAACTTTAACTTCCTAAGGCGGGATAACAAATTTATCTTGCGATAAACATGAAGGGACCGGATTGTTCACTGTCAGGTTG
TTGCTCACAGCAGACAGGGCANTGNCTTN
Sequence Type genomic DNA
Unitrap ID UNI13393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45591198..45591385 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST15082C6BBF2
Sequence
GTGTCACAGCAAACCAGAGGGCTGTGCTCCAGGTGACTCATGGGTAAAAGCAGTTGCCACACAAGCCTCACACCCTGAAT
CCTGTCCCTGAGACCCACATANAACTTGAAGGAGAGAGCTCACTTCCGAAAACTTGACCTCTGACCTTTATCTGCATGCC
ACGGCAGGCCTATTTACATACATACGCACAAATAAACTATATATGTGTATATGACATATGCGTGCGTGTGCATGTATGCA
TATGTATCATATAATTTGGGGGTCTGAGGGTGTGGTGGCTCAGTAGCAGATGCGTAAGAGGCCTAAATAAATAGAATAAA
AAAATAGGTTTATGGGGCTGGAGAGATGGCTCANCAGTTAAAAGCACTGACTGTTCTTCCAGANGTCCTGAGCTCAATTC
CCAGCAACTACNTGGTGGCTCATGACCNTCTGTAATGAGANCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141125081..141125524 432
 
EST/CDNA Est Name
  CB597657.1 - BY720827.1

 
Come back to gene CB597657.1 - BY720827.1


For any suggestions or comments, please send an email to unitrap@crg.es