Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10836-NL
Clone ID PST10836-NL
Vector U3NeoSV1
Project escells

Sequence tag PST10836-NL
Sequence
GAACTGGGTAAAACCATGCAAACCAGGAGATGCGTTCCCCGGGGTCAGCCAAAATAGCAATACACAAAATACAGTCACCC
CCTCTGGATTCCTCTATGTCACTTTCCCAGCCATTAGACCATTAGCATCAGGTTCTGGGTCTCCTCACCTAAATCAGAGG
CTAGTGGGACTTAGGACAGCTGGTGGTGGACATACCTGGGTTCACGTATGCCGCATTAGAACCTTGACATTGGACCCCAT
AGGATTTATAGTAGAGAAATCACTGCAAATCAGGGCTTTAAGG
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805219..126805501 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es