Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13224C12
Clone ID IST13224C12
Vector VICTR74
Project tigm

Sequence tag IST13224C12HMR1
Sequence
CAGTATATGGTAGACATTATAATAGAGTTCTATAAATAAATGGAAGGAACTTAAGAACATTGTAGAGGTAAGGTAAGATA
AAATGAAAGACTACGTAACTGTTTAATAAGTGTAGTTTATAGCCTGAACTTCAGCTCCTCTTCCTAACTTACTCCATGAA
ATTTGATAATATTGCCATTCTCAAACTATGTAACCTGTTATTAGTTGTAGAAATAGGAGGCAGGTGAATTTTCTGGTCGT
GTTTTACAAAAGGANAGTTGTAGTTAGCGTGTNTNANACNNCTCCNATTTCTAACAAGTGAACATCTGGTGCTCAGAAAC
CTTACCNNNNNCNTTGGTTCTCTTTGAACACCTCTTNCN
Sequence Type genomic DNA
Unitrap ID UNI938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130312374..130312729 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]


Sequence tag IST13224C12BBF1
Sequence
AGATCACTGTCCTCCAGCCGCAGGGCTCCTTCTTCCCCCCTGGGGCTGAACGACCAGCTGGCCTCCCCAGCCACCCTCCA
GGGCAGACTTCTATTCTCTTTATGAATAGAAAGCGAGCCCAGAGAGGTTGAGTGACCGCGTCAAGGTCGCCCAGTACAAA
ANACCGGTAGCCTGAGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141155019..141155202 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006219 (Fblim1) NM_133754 filamin binding LIM protein 1 Gene [Source:MGI (curated);Acc:Fblim1-001]

 
Come back to gene ENSMUSG00000006219


For any suggestions or comments, please send an email to unitrap@crg.es