Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14811C11
Clone ID IST14811C11
Vector VICTR76
Project tigm

Sequence tag IST14811C11BBF1
Sequence
AGTTCAATTTTTTTTTCCCAANACTGACTGGGTTCCTCTGTGTANCCNNANCTGTCCTGTAAACCTGGCTAGCCTCAAAC
TTAAAACATCCGCCTGCCGANAAATGTGCCACCATGCCTGGCTGGGTTCAATTTTTTTAAAAAACGTGGCAAAATCAAAA
AATTCCCTTTGCCTCCTGAATCTATCCCACANATGGATATACTCATACNCAACGAAATAAAAACACTTCACTCAACAAAC
TCTGGTTATTCTTTTCTTTTTAACCTCAATATGTATCAATANCTCANTTATGAANCATCCNCNTGTATCTAANTGCTGAA
ATGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14811C11HMR1
Sequence
AACTCAAGTCNGGAGTGATGTCCACTTGGAAGGCAGAAGCAGGTANATCTCTGTGAATTCAAGGCCAGCATGGTCTACAG
AGTTCCAGGCAGCCTGACCTGTATCAGGAGAGAGACCCTCCTTCAGCCTCGTGAGCTCCTTTCTTGTTAGGGCTGGGAAG
TATGTTCATGTTGTCCAGTGTGTGTGAGCACAGTTTGTGCTTCCAGGCCGAGGCACAGTCC
Sequence Type genomic DNA
Unitrap ID UNI18463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106975804..106976023 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]


Sequence tag IST14811C11HMF1
Sequence
AGTTCAATTTTTTTTTCCCAANACTGACTGGGTTCCTCTGTGTANCCNNANCTGTCCTGTAAACCTGGCTAGCCTCAAAC
TTAAAACATCCGCCTGCCGANAAATGTGCCACCATGCCTGGCTGGGTTCAATTTTTTTAAAAAACGTGGCAAAATCAAAA
AATTCCCTTTGCCTCCTGAATCTATCCCACANATGGATATACTCATACCCAACGAAATAAAAACACTTCACTCAACAAAC
TCTGGTTATTCTTTTCTTTTTAACCTCAATATGTATCANTANCTCANTTATGAANCATCCNCNTGTATCTAANTGCTGAA
NTGAACCANCTGTAATCTGGGCTGGANANTGCCCNCAACAGCNNCACACACCTTTANTGCTTGGTAGGCATGGTCNANNT
AGTGAATTTCANANNNNCTTGGGCTTCAAANANAGGTCTGCNTCAAAAAAATAAAATNANNTAAANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es