Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10997E3
Clone ID IST10997E3
Vector VICTR76
Project tigm

Sequence tag IST10997E3HMF2
Sequence
TTAATATACAAATTAAGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAA
CAGGGGAAACTGTGTCTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGA
NAAAAATGACTTTACAATAATGTTTTCTTTTTGGA

Sequence Type genomic DNA
Unitrap ID UNI15588 UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10809866..10810059 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29592628..29592821 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920226..52920419 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939802..136939995 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776707..115776900 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41654451..41654644 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84779933..84780126 192
NO GENE  


Sequence tag IST10997E3BBF1
Sequence
TTAATATACAAATTAAGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAA
CAGGGGAAACTGTGTCTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGA
NAAAAATGACTTTACAATAATGTTTTCTTTTTGGCCAAAGAATTGTTTTGGGCACAACCAATTTTTAATTACCAATTAAT
AACAATTATAAAAGCTTTATTTTTTGTANAAACTTTTGTANTAAACTAAAACCCTAAGTAATAAAAGGATATTGTCTCTG
AATCTTTTGGGTGAGAGCAAGGATTTAAGGTAAACTTCAANANNCATTAGTTAATAAAATACTTTTNACTTANGAAACNA
TATACNCTGAAAGATTAAAAATCTTGGCTTCTTGTATAGAAGCAGAAACNANNACNATTTTTTCTTACATAATGTAAAGT
TACATTAGCCNTACCTAGNNGCAAAATTTNNTANTGATTACNGTTNACTANNAGCAAAACTNTTTGANNTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es