Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10401-NL
Clone ID PST10401-NL
Vector U3NeoSV1
Project escells

Sequence tag PST10401-NL
Sequence
AAGCAGCAAGGGGTCTTAGCTGGGGACTAAGTACATTCAGTGCTAGGTCTGCCCAATCGAGGCATATGGCTTATAACCAT
AATAACTGGGTTGTGTGTTTTTATATGGGCTTATTGGAGTTGGAAATTACAGCAACACGTAGTACTCGTTTTATTTGCTG
CCATTCCATTTAGGTTTAGCTTGACTTCATAGAAGACAGATTTTTTTAAAAAAGATTTATTTATTTTCATGCATATGAGT
ACACCGTATCTGTACAGATGGTTGTTAGCCTTCATGTGGTTG
Sequence Type genomic DNA
Unitrap ID UNI14936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58434960..58435241 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021965 (F630043A04Rik) NM_198605 RIKEN cDNA F630043A04 gene Gene [Source:MGI Symbol;Acc:MGI:3041235]

 
Come back to gene ENSMUSG00000021965


For any suggestions or comments, please send an email to unitrap@crg.es