Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14621G8
Clone ID IST14621G8
Vector VICTR74
Project tigm

Sequence tag IST14621G8BBF1
Sequence
CGAGCACATCTGCAGTTACTATGGAGATGGCCAGAGGGCGTTCCTGGGATGGTGACGTCACCTTTCTGCAAACTCCTTTG
CCCTGCTTCAGTCCCGACAGCAGTCTCTTGTTAAGATGCTTCCCTGCTGAGTAAGGTTCAGTTCCCAAGGGCTTAGTCTG
GAGCTTGCAGAAAGACAGACAGACAGACCAAGAATTGCCTTGCTTTACACCAGGTATCCTGGATCATGCCTGTAATNNNN
NNGTTNGNNANATGGAGGCAGGAGCATCAGGAGTTACCTTTTAAAGTTANCCTGANCTNTNANACCTTGCCTGANNATNN
NANNTNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14621G8HMF2
Sequence
CGAGCACATCTGCAGTTACTATGGAGATGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95028429..95028462 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]


Sequence tag IST14621G8HMR1
Sequence
NANCTAATGAAAATGACCTCGTTTATTTATTTACCTTACATTTATCTATCTATCTATCTATCTATCTATTTTTGAGACAG
TGTTTCTCTATGTAACCCTGGCTGTCCTGGAACTCTCTGTGTAGACCAGGCTGGCCTCGAACTCTGAGATGATCTGCCTC
CCTAGTGCTGGTAATAAAGGATCCACCACTACNCCTGGCTCTGACCTAATTTATCTTTAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 135697370..135697596 225
NO GENE  

 
Come back to gene ENSMUSG00000053192


For any suggestions or comments, please send an email to unitrap@crg.es