Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14203B9
Clone ID IST14203B9
Vector VICTR74
Project tigm

Sequence tag IST14203B9HMR1
Sequence
TAATAAAAAATACACACTTAAAACCAGCTATTGCAAAACTATTTTTTGTTTTGAAATTTTCATATAATTGTGTANTTAAT
GGAAATAATCTAATTGGCCGGCTTGTCNTGAANCATTATTTATATTTTCGAATTGCCCAATATTTCAGTTTATTGATCTC
AAGCATTAAATTTTAAAGATTTTGCAAAATGATTGCCTATGCCAAAACACATTATTTAAAAGTAAATGCAATTATAGTTA
TTTTCTAAAGAAATTGTTTTAAATATAGACCAANTAATTAAACATAATTTTTAAAAAAAATAACACAAAATTTGTTTTGG
ANTTCAAATAATGGTTATTATNATNCCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131544352..131544699 334
 
EST/CDNA Est Name
  CN694274.1


Sequence tag IST14203B9HMF1
Sequence
ATAACAAAAATAACAGTATTTAAGCATACATCTACGTGACAATTTGTATGTTTTAAAGGCAGGGAAATGAACATAAAATA
TTGGAGTTCTAAGGGGTTTGGGGGAAAGTGATGAGAATTAAACGCTGAGTAATAGTTCCGTTCTTCCACTGTGCACCAGA
TTTACGGTAATTTTGATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI34999

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131544171..131544352 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052676 (Zmat1) NM_175446 zinc finger, matrin type 1 Gene [Source:MGI (curated);Acc:Zmat1-001]

 
Come back to gene ENSMUSG00000052676


For any suggestions or comments, please send an email to unitrap@crg.es