Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10928F2
Clone ID IST10928F2
Vector VICTR76
Project tigm

Sequence tag IST10928F2HMR1
Sequence
TATGTATTATGTATGTATGTATGTATGTATGTATGCATGCATGCATG
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110362047..110362093 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es