Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14922D8
Clone ID IST14922D8
Vector VICTR76
Project tigm

Sequence tag IST14922D8HMF2
Sequence
GTTCCATTGTAGCCTATAGTAAGGGTTTGGTTTTCCCCTGCTTTCTTAAGAGTGTGTGTGTTGGGGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34164197..34164271 75
NO GENE  


Sequence tag IST14922D8BBF1
Sequence
AAATAAATAAATAAATAATAAAAATTGTTTAAAGTTTCAGTGGTGGCAGCAGCAGCTGAGGCATGGAGCCACACTGTCCT
TGTCAGCACGGACAATGAGAAAGGTAAAAACCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 112995174..112995290 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042873 (Lhfpl4) NM_177763 lipoma HMGIC fusion partner-like protein 4 Gene [Source:MGI Symbol;Acc:MGI:3057108]


Sequence tag IST14922D8HMR1
Sequence
GAACATTGTAGTGCTATGTGAACAACATAGGCAGAAATCAAACCAAACCAACAACAGAAAGGACAGNNCNTGGTAACACT
GCAGAGTTCCTGGAGTGGGCGTGGAAACCATCANAGAAGGTTAAGTTCTGATCACATGCTAAGCCGACAAAGAGATCTTT
CCGAAGTGCAAAGGATGACTACATCTGGAATCTGGAGTCATCTGCTGCAAGAGCTTCCGGTTTAATCATGANAGCCATGC
CTCCGTCAGCTTTGGCGAGTGTANATCATGCTGTCAGGAGAGCAGCCAAGACTTGGGATCANATGCNATTAATTTGTTAA
AGAAACATGAATCANAAATCCTCATCCATGCTTANTTTCAATAACTTGTTTTACAAATGGGTTGAAAATTGATGAGTGAA
TTCNAAGGCANAACGACTTCNNANTACAGTTATTTTGGCGGAGTGCTGTGCANATAAACAGTATTTAAAAGGGGCTCTGG
TTGGCAGTAATCNTTTTCACTGCNNGCCTGGCCTCTTTTGGTGTCACAGAANCNTGCCATGANGANTTTGANGTCTGTGT
GTGTNANANNNNTGTTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042873


For any suggestions or comments, please send an email to unitrap@crg.es