Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14191D6
Clone ID IST14191D6
Vector VICTR74
Project tigm

Sequence tag IST14191D6BBF1
Sequence
CACCATAATAAAGAGTTTAACAAATACAATAAACTTTAGGTCAACCTCCAAGCCTTCTGAAGCAAGCACTCCAGTTTTCA
CAGGGTCCATCCACATAAGTCCAGAAATCCACTGANATGGTCTTATTGTATTTTAGTCCTGATGAGATTGCCCTGGAAGG
GGTGACGGGCAGACGGACCAGTGGTGTGACTGTGTTCATGGTAATATGCATTTCCAGGGCCAGGCATGGTGGCGCATGCC
TTTAATCCCANNACTCGGGAGGCANAAGCANGCGGATTTCTGANTTCNANGCCNGCCTGGTCTACAAAATGAGTTCCANG
ACAGGCANGGCTNTACAAAGAANCCCTGTCTCGAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121254131..121254487 331
 
EST/CDNA Est Name
  BB861417.1


Sequence tag IST14191D6HMF1
Sequence
CACCATAATAAAGAGTTTAACAAATACAATAAACTTTAGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121254446..121254487 42
NO GENE  


Sequence tag IST14191D6HMR1
Sequence
GGTGTAATTTTGGTTNAATAGAAAAGTCNAGAGTACAGACAGTTCCCATGGACCCATTACCCAGCAGCCTCCTGTAATGC
TAACATCCAGTATAACCACGGACCTCAGCCTTGTGAGAGCCATGGGTGTTCTCAGACATGCACACTGAGTGTGANGCCCG
CANCCCTGGCATTGCCANCCCTTTGGAAGTACTCACGCTTCACCTCGAGGGTCCAGCGTGGACTGTGACN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121254484..121254712 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es