Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10298-NR
Clone ID PST10298-NR
Vector U3NeoSV1
Project escells

Sequence tag PST10298-NR
Sequence
CACGTAACGATTATAGGTGGAGTCTAGGGACACTGGTTTGCACTTAAGATTCTAAAGTTGTAAAATGAAGAGACAGTTTG
AAGAACTATAGTGAGGAACAAATATATATAATAGTAATTGATTTCATGTGAACGAGATTTTTTTTTATATTCTTGGGAAT
CATTTTTGCTGCAGGTATGCCCCCACCTGTTCACACGTCCTGGAATTCCTCCAATGACTCAAGCACAGGCTGTTTCAGCA
CCAGGTATTCTTAATAGACCACCTGCACCAACAGCAGCAGTACCTGC
Sequence Type genomic DNA
Unitrap ID UNI15247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 80205170..80205448 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017421 (Zfp207) NP_035881 zinc finger protein 207 Gene [Source:MGI (curated);Acc:Zfp207-002]

 
Come back to gene ENSMUSG00000017421


For any suggestions or comments, please send an email to unitrap@crg.es