Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10672B8
Clone ID IST10672B8
Vector VICTR76
Project tigm

Sequence tag IST10672B8HMR1
Sequence
CTACAACTGCTGGATGAAAGGAGAATGGTCCACAAAGCCTTCTATGTACTTAGGGATTTCATTTGCTTCAAATGACAGTT
ATATCTCACTTCTTTAACCTCAGTAGAATACATTCAGGCCTCTGAGCATT
Sequence Type genomic DNA
Unitrap ID UNI29646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135683759..135683888 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es