Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10083-NL
Clone ID PST10083-NL
Vector U3NeoSV1
Project escells

Sequence tag PST10083-NL
Sequence
CTTTTGTGTTGGAGGAGGCCGTCGGCTTCAAGGATCCAGCAAAAGTGGACCTGGAAAGGGAGGCAGCCGGAAGGAGGCCC
AACTTCCAGTTGTTGCAGGACCCACCAAAGCTAGGTGAGGAGCTAAGGCAGAAATCAGTTCTAGAGGATACAGATAGCCA
GTGGTAGAGTTACCTCCTTGGGTATCCTGAGGACCTTTGTGGGGTGGAGATTGTCAGCCTTATTGTAGCCATGCTCTTGT
CCTGGGTTAACTCCAAGCCACTGGGCCTTTATCTGGGTGAGCC
Sequence Type genomic DNA
Unitrap ID UNI15061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181325397..181325677 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000823 (Znf512b) zinc finger protein 512B Gene [Source:MGI (curated);Acc:Znf512b-001]

 
Come back to gene ENSMUSG00000000823


For any suggestions or comments, please send an email to unitrap@crg.es