Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14195A9
Clone ID IST14195A9
Vector VICTR74
Project tigm

Sequence tag IST14195A9HMR1
Sequence
ANGGACTTTTGTAGCTCTCAAAGTTTCTACTTTCTTCCCCCTCAGTTTTTCCTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102933251..102933306 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es