Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15023H3
Clone ID IST15023H3
Vector VICTR78
Project tigm

Sequence tag IST15023H3BBF1
Sequence
NNGCTCCCAAAGGCATCAGTTGGCTCAGGCCTCTAATTTGGCCNAAAATAAACACCATTCCTCAAACAAGAATGCAGTTA
CCGAGGCCTGAGAACTGCTGCTAAGGAAGGAGAGCTAGGGTGCTCAGGTAAGCTGAAGCAAAGCCTATGCAAAGTAGCAG
TGAGCGTCTCCTCTGGGGAACACACTTGTCCTGCACAGCACTCAGGGATGGATTTCAACTGTCAGGGCATAAGGGATACT
CNGAN
Sequence Type genomic DNA
Unitrap ID UNI31171

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66361502..66361743 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050503 (Fbxl22) NM_175206 F-box and leucine-rich repeat protein 22 Gene [Source:MGI Symbol;Acc:MGI:1921415]


Sequence tag IST15023H3HMF1
Sequence
NGGCTCCCAAAGGCATCAGTTGGCTCAGGCCTCTAATTTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI31171

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66361702..66361744 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050503 (Fbxl22) NM_175206 F-box and leucine-rich repeat protein 22 Gene [Source:MGI Symbol;Acc:MGI:1921415]

 
Come back to gene ENSMUSG00000050503


For any suggestions or comments, please send an email to unitrap@crg.es