Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14455H7
Clone ID IST14455H7
Vector VICTR74
Project tigm

Sequence tag IST14455H7BBF1
Sequence
GTTTGTCGCTGGGACCTTGGAAGGAAGGGTAGGTACTGTTTATGTCTCCCCAAGGGAAGGAATTTTGGCAAAAGACGTGC
TCGAAAAAAATGGGACGTTTTGTACTAGCGTCAAACTCCAGAGAAGGGTCACGTGAAAAAGGGGGGTCTGGAGAGGTTCA
GACGCCTAAGATTCGTTAGACAGGTGGAGATGGAAAGAGAAGGAGAATGAGGAGAGCGGTGGGAGTGGAAAGGGAGAAAG
AGACAGAATCACAGAGACAGACAGACACGGGGCGACAGAGGAAGGAGCGATGAAGAAGCCATGGGGAAAATATGGAGAGG
AAAGAGAAAAGCTAAGGCCGCNTGCTCGCTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96316049..96316399 346
NO GENE  


Sequence tag IST14455H7HMR1
Sequence
TTTGTACCTTCTGGTGGGCCTTGNANCAAGAGCCTCCAACACAGCTGCTCTGCACTTTGCTAGTGGGGTAGATGGAGGCT
GGATCATGGTGT
Sequence Type genomic DNA
Unitrap ID UNI1820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123362572..123362662 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es