Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0421
Clone ID GC0421
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0421
Sequence
GGAAAATACCCTCTTTGCTGAATAGCTGAAGGCTTCTCAAAACCATATGCATAGATGCCTCGAAGAAGGGACTCCTTTAA
ATTCATATCATCAAAGTTATCAACAATTTCATTCCAGTTGCTCTCGATGACACCATCGGGGTCCATTCCCTCTGGGCCGC
CATGTTCTCTGTTGTAATCCGCGGAGCCACCAGACATGATCCGAAAACCCACTCAGCGCCCGACTGAAAATAAAGCCCCC
C
Sequence Type mRNA
Unitrap ID UNI246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23107827..23108912 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es