Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14209G12
Clone ID IST14209G12
Vector VICTR74
Project tigm

Sequence tag IST14209G12HMR1
Sequence
GCTCTAAGGCGTATATTAAGCAACTGCCTCAGAATGAAGGTGCTAGTGATATTCAAGAATGTGCTTTAGATTGTTATTAT
CATCATGGTGCGTGGGATCAAACTCGGANCCTTGTGCATGCTACACAAACACTCTACTACAAGCTGGACACCCAGCCAAC
AGGCACCCCCTTCTGTGGGTGTTTTCAGTAACTGGATTTCAAGCATAAGCACATACAAGGGCAACGCANGCAATAAGGGC
AACAGTTACAGAGCATCTGGGTCTCACACTGGGTGGTGAATCTGCTGGGCGAACAGTTCTTGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI32135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71610116..71610421 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]


Sequence tag IST14209G12HMF2
Sequence
GAGCAGTGTTTCTCAACCTGTGGGTCTCAGCCCCTTTGAGGGTCAAATGACCCTTTCACAGGGGTAACATGTCAGATATC
CTGCATATCTGATATCCTGCACATGATATATTTATATTATGATTCATAACAGTAGCAAAGTTACAGTTGTGAAGTAGCAA
TAAAAATAAGTTTATAGCCGGGCGTGGTGGCACATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATATCTG
AGTTCAAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACTGCCAGAGCTATACAGAGAAACCCNGNNNCAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71610418..71610730 305
 
EST/CDNA Est Name
  BB847193.1 - BY207956.1 - BY299930.1 - BY199737.1 - BY184213.1 - CJ077707.1

 
Come back to gene BB847193.1 - BY207956.1 - BY299930.1 - BY199737.1 - BY184213.1 - CJ077707.1


For any suggestions or comments, please send an email to unitrap@crg.es