Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13224H9
Clone ID IST13224H9
Vector VICTR74
Project tigm

Sequence tag IST13224H9HMR1
Sequence
TAAGCTCATACATAAGCTCAGAGTTGGATCAAGACCAACTTCCACCATCAAGGTTATCCCACAAATTTCACCTTTGTCCC
TTTCCTTAGGTCACCATCTTCCTGCAGGTTATTTAGAAACTGCTCCTTAGTTTTGAAATACTTGAACATTTATTTCCCTT
TCATTGTTGTTACTGTTGTTTCTGATTTCTAGCTTGGTTTCATTGTAATCAGAGAAGACATTTAGCCTGATCTTTTGTTT
CAAGTTTACTGGAGCTTGCCTGGGGTCATCTTGGGGTGTGGTCCATGGATATTTTGAAAGACAGGTACATTCTACTATTT
AATACATTGTTCCATAAATGTTGATTAGGAATTGTGGCTTGATGGAGAGCTGTTGGGTTCTTTATTGTTGATTTTCTGTT
TTATGAACTTTTAAGCNACTANGACAGGGTGACNGGGATGGGGGGAGGTGGANGGGGAANGGN
Sequence Type genomic DNA
Unitrap ID UNI22378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 77105248..77105705 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042272 (Sestd1) NM_175465 SEC14 and spectrin domains 1 Gene [Source:MGI (curated);Acc:Sestd1-002]

 
Come back to gene ENSMUSG00000042272


For any suggestions or comments, please send an email to unitrap@crg.es