Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14820A12
Clone ID IST14820A12
Vector VICTR76
Project tigm

Sequence tag IST14820A12HMR1
Sequence
GTTCTTAGGTAGTCTGGATGGTAGAGTGGGAGTAGAATTCAGTACCTGAGGGGGACAGACTCCTTTGGAATTTGTATGGT
TCAATAAGCTTTTTCTCTGATGGTAGGCCAGAAATTTGCTTGAATTTGTTTGGGACTGGCAGTCAGTGACTGTGGTGGTT
GGGATGTANAACTANATTCTCTGTGANAGAAGGTTTGTGCATTTCTTTCCTTTTGAAAACATATTTATAGCANAACTACA
CTCTANGCTGATATGACACANACTCTNTCCTTTGCTGTAANAGATTTGGTGAGATTTGAACGTACTTCTACTGATGCCGG
TACCTCATTGGGGTGACAGGCTTTNANGATGGANGTGGANTANAAN
Sequence Type genomic DNA
Unitrap ID UNI16349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4809227..4809592 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006456 (Rbm14) NM_019869 RNA binding motif protein 14 Gene [Source:MGI Symbol;Acc:MGI:1929092]


Sequence tag IST14820A12BBF1
Sequence
CAGAACTACATGCTTGCTTGGTTCAGCAACCCAGTTCCCTTTGACGGTACATAGAAATCACAGTATTTGGGGCAAACTTT
ACGTAAAGTGAGAGTAAACCGGTGACAGTGGTGTGATGACCTATACCTGTCCTAGTTCTCAGGTGCCTAAGGCAGGATTG
CCACGAGTTCCAAACCAGCCGGGCTACATAGTGAGTTCCAGGTTTGCCCGGGATATACTTAGTCATCAGCCGACCGATAA
TAGACGACTGAAACACTCATTTTAAGGGTCAGATAGTTGACGTTGCTGAGAATTATTCAAAGCCGGTTATATAAGGTAGA
GACTCGGAGGGAATTGGAAGGAAAGAAAATTANATCTGTCATGCTAAATCATAGCGCGTCCTGGGACTCGCACGGCTACN
TGAAACCTCCTGTATCNNAAAGGCTCTGCTCTTTGCTTGTTNNAGAAATACTGGCAACCGGATCATCTNCAAGTTTTTGG
TCCNCCCTTGTGCTTTCCTTTTATGACNGANANNANGGANGTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 143114619..143115142 496
 
EST/CDNA Est Name
  BU936307.1

 
Come back to gene BU936307.1


For any suggestions or comments, please send an email to unitrap@crg.es