Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15040G4
Clone ID IST15040G4
Vector VICTR78
Project tigm

Sequence tag IST15040G4HMF1
Sequence
CTACTACTGGCCGAACTCAGTTGTCCTTGGGTACCCTGCTTTCTGGCCTGCCCCCCAGAGACAGACAGCATCAAGCATGG
TACAAGTACAGAGTAGATGCTAAACAAATGTTCGTGAGCATGTTGATAAGTGACAATCAGCTGCGCTATTTGGAATGAGA
CAATATTGTTGGTTACTACAAAACAAAGTTGGGAACACGCTGCATTTCTTTCTAGCCTGCACAGGAGCACCAACGGACTG
CCTTTACCTGAAGCAAGACCTTCACACACTGTGGCTGACAGGAAATGGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96483571..96483864 292
NO GENE  


Sequence tag IST15040G4HMR1
Sequence
GAATGTTCAAATAAAANTGTGTTTGGTGGGAGGGGCTAN
Sequence Type genomic DNA
Unitrap ID UNI20190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96483906..96483943 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es