Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14246F3
Clone ID IST14246F3
Vector VICTR74
Project tigm

Sequence tag IST14246F3HMR1
Sequence
TCACCAGCGCCAGGTTGATTTTCTGATGGCAAAATACATAATGATATAGGAAGATCAACCTTTCTCCTCTTTAAAGCAGC
AATTTGAATAGCCTTCTCTACTAACTTTAAG
Sequence Type genomic DNA
Unitrap ID UNI1773

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81117448..81117557 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074860 (EG210583) predicted gene, EG210583 Gene [Source:MGI Symbol;Acc:MGI:3644409]


Sequence tag IST14246F3HMF2
Sequence
NGGCNCANCGGGNAANAGCACCNGACTGCTCTTCCAAAGGTCCGGAGTTCAAATCCCANCNNCCACNTGGTGGCTCACAA
CCATCTGTAACAAGATCTGACGCCCTCTTCTGGAATGTCTGAAGACAGCTACAGTGTACTTACATATAATAAACAAATAA
ATCTTTAAAAAAAAAAAANNAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14246F3BBF1
Sequence
TTATGGCTCAGCGGGTAAGAGCACCTGACTGCTCTTCCAAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCA
CAACCATCTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI35008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81117347..81117446 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31851952..31852051 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]

 
Come back to gene ENSMUSG00000022770


For any suggestions or comments, please send an email to unitrap@crg.es