Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14284D6
Clone ID IST14284D6
Vector VICTR74
Project tigm

Sequence tag IST14284D6HMF1
Sequence
AATCCCAGCACTTGGGAGGCAGAGGCAGGCGTATTTCTG
Sequence Type genomic DNA
Unitrap ID UNI19507 UNI33444 UNI35009 UNI35010 UNI35011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4856624..4856662 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 90560639..90560677 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019975 (1200009F10Rik) NM_027078 RIKEN cDNA 1200009F10 gene Gene [Source:MGI Symbol;Acc:MGI:1914704]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3478924..3478962 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 12894764..12894802 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51754963..51755001 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 75802048..75802086 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 89614451..89614489 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063260 (Syt10) NM_018803 synaptotagmin X Gene [Source:MGI (curated);Acc:Syt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 58300894..58300932 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34659781..34659819 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4181542..4181580 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7707813..7707851 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116305937..116305975 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033439 (Ccdc76) NM_030016 coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 104107803..104107841 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3491199..3491237 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053338 (CAAA01179078.1.1.20098) NM_177363  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 36360856..36360894 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72807522..72807560 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032210 (Dyx1c1) NM_026314 dyslexia susceptibility 1 candidate 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1914935]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12883825..12883863 39
NO GENE  

 
Come back to gene ENSMUSG00000032210


For any suggestions or comments, please send an email to unitrap@crg.es