Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15101F2
Clone ID IST15101F2
Vector VICTR80
Project tigm

Sequence tag IST15101F2HMF1
Sequence
NAATGTGTGGCAGTAGCCAAAGGCCTGGAACCAGACCAATGACTCATTGCAATGAACCTTTGCAAGTAAAGATGTGTNNN
NNNNNGGGTACACTGTGGGACNCACTGGGACACACCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15101F2BBF1
Sequence
GAATGTGTGGCAGTAGCCAAAGGCCTGGAACCAGACCAATGACTCATTGCAATGAACCTTTGCAAGTAAAGATGTGTGGA
CAAAGGGGTACACTGTGGGACGCACTGGGACACACCACAGCTTCCATAATGAGATGTTTTCTATGCTTTGTTTTACGTTT
GTTTTCATTTGGAGGTGTGGGGGTTGCAAGGGTGGGGGGTGGATACAAAGGGATGGGGAGATGAGTGAGTTGGGGTGCAT
GATGTGAAATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114626132..114626382 251
NO GENE  


Sequence tag IST15101F2HMR1
Sequence
NTNNNNNNNANNNNNNNNNTNTNNNNGNNANCNNGGNGTTNNNNNNNNNNNNNNNNTGGTGNNGNNGANNCTGCACCTTT
GGAGCTGTANAACCAGTCCTTTCACACGCTCCAGCGGTTCACAGATGAGAGCGATTTTAGGGTTAGGCCAACTCAAAGCC
CTGGATCTAGGCTTGGTTGGTGGCTTGAGTTGATCAACTGGGACACTTTCTGAATTGAGTTTTCCTCTCCCCCCAGCTTA
TGTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114626451..114626629 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es