Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10512H10
Clone ID IST10512H10
Vector VICTR76
Project tigm

Sequence tag IST10512H10HMF1
Sequence
AAGGAAGTGGGGAGGGCGTTGTTGGAAGATACCAAAGATACCAGTTAAGAGTCACAAGGAAGTGTAAAGTTACAAGAGTC
ACAAGGAATACCTGGTAATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31318 UNI31319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7488578..7488683 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 25503040..25503145 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 28045682..28045787 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 89578763..89578868 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 19228819..19228924 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021314 (Amph) NM_175007 amphiphysin Gene [Source:MGI Symbol;Acc:MGI:103574]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52175384..52175489 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079244 (EG434459) NP_001013838 predicted gene, EG434459 Gene [Source:MGI Symbol;Acc:MGI:3646060]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 44741663..44741768 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 51642838..51642943 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37328273..37328378 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 12317723..12317828 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 51816557..51816662 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 138838220..138838325 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10972130..10972235 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32883300..32883405 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 19434413..19434518 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108655364..108655469 106
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 69486046..69486151 106
NO GENE  

 
Come back to gene ENSMUSG00000079244


For any suggestions or comments, please send an email to unitrap@crg.es