Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14856F3
Clone ID IST14856F3
Vector VICTR76
Project tigm

Sequence tag IST14856F3BBF1
Sequence
TCGGGAGCGGGGCGTGGGGGCGGGGATGGACATGAACGATTTTGTAGGTCCCCACTGGTCATCCGGAAAGTTAACGATGC
TTCAGGTACTAGGCTAGGGACAATGACAGCCTTTCCAAGGCTGCTGGCCCGGAGGTCGGCGTGGAGCAGCTGAGCCTTGG
GCTGCACTGGGGGTCCCTAGTTTTCTAGAGGCAGAGGTTGCGACTCTCGATTCGGAGGGGCTAGGTCCACGACAGACCCC
GAGTCTGGCGAGCGCCAGCCGGTGGCCGGGCACCGGGCGCTCCCGCGGGCTCCGGGAGCCCTCCCACTCTTGCCAACTTT
CCCTGCCCTGGTGCCGGANGAGGGNNCCTTTNNNAGTGN
Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109394334..109394691 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]


Sequence tag IST14856F3HMR1
Sequence
CCGAAACCTGGAAACCTACTCACCCTGCAAACGGGCTACCCCANAAAATCTTCTGAACGCCAAGGGGCGGCTCGCTATGT
GAGGGGACTCCCTAAAAACCTTCCCGGTGGCAACAGANAGGGACAGAAAAGAAAAATTGTCAAATAAAAGGAGGCTGGTC
AAAGAAGGTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109394166..109394337 168
NO GENE  


Sequence tag IST14856F3HMF1
Sequence
TCGGGAGCGGGGCGTGGGGGCGGGGATGGACATGAACGATTTTGTAGGTCCCCACTGGTCATCCGGAAAGTTAACGC
Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109394334..109394409 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]

 
Come back to gene ENSMUSG00000031910


For any suggestions or comments, please send an email to unitrap@crg.es