Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10133-NR
Clone ID PST10133-NR
Vector U3NeoSV1
Project escells

Sequence tag PST10133-NR
Sequence
GAGATGAACACCTTCCACAGTTATGGTTGAGGGAATCCTCGTGCAGAGGGTGGGGCCCGTGAGCACCCTGATTGGAGACA
GAAGTGAGCCAGCAACTGCCTGGTGCTGAGGGGACAGGGTAGTCTCCGATTGTAATAAAGCAGCGTTCTGTTGGCCCCAG
CTCGCCCAACCCATGAGCTGAATTTGAGTGTAAAACCTACGTTTAGTGGAAACGTGATTTGGCTACTACAGCTTTACATT
TAGTTCTAAAGTGTTGTTTTAACGTGTAACCTAGAGCATGGGTG
Sequence Type genomic DNA
Unitrap ID UNI14930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27768478..27768761 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]

 
Come back to gene ENSMUSG00000052146


For any suggestions or comments, please send an email to unitrap@crg.es