Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14878B7
Clone ID IST14878B7
Vector VICTR76
Project tigm

Sequence tag IST14878B7HMR1
Sequence
AAAGAAGCTATTGATTCTGAAGTAGTGGGTTTTGATTGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI14777 UNI20889

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84961381..84961422 42
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 137529620..137529661 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037894 (H2afz) NM_016750 H2A histone family, member Z Gene [Source:MGI (curated);Acc:H2afz-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 116124350..116124391 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060214 (AC147612.5)  


Sequence tag IST14878B7HMF2
Sequence
CTTTGAAGCCACAGTAACACTTAAATATGGTTAAGCCTCGAATGCACAAATTTGGTTGGTTGGAAGGCTAATTAAGCCTC
CAACTTGCTCAAATAGAATTACAAAAAGGCAAAATTGTGTTTTTCACAGAGATACAGTCCACTGGAATCACCAACACTGG
ACAGCTGTTAAGATTATTTAGAGTCCTGAGATAATAAGGAATGCAGGCATCCTTAAATAGTCTTCTGTTGTCCTTTCTTC
CCAATCAGCGATTTGTGGATGTGTGGGATGACACAACCACCANCNNTGGTAGCTTTGATCANNNAATCCAATTCTTCATC
TCCACGTATAGCANGCTGCAANTGACAAGGGGNAANACACTTTACCTTTANNTCNNTNGATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000060214


For any suggestions or comments, please send an email to unitrap@crg.es