Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14449E3
Clone ID IST14449E3
Vector VICTR74
Project tigm

Sequence tag IST14449E3HMR1
Sequence
ATTCTAGCCGAGCGGTGAGCTGACAGCTTGGGGTAGCCNTGCTAGTCCACCGTTTGGGCTGAGTCTCAAAAGCTGGATTT
TCAGGTAGCGGAAGAATGGCCTAGGGTGCAGGTCANGGANAATTTTAAGGGTAN
Sequence Type genomic DNA
Unitrap ID UNI20107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26538830..26538962 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]


Sequence tag IST14449E3BBF1
Sequence
GAATCTCTCATTTTCCAAGACGCCGCCCCCCGACACCCCTTTCCCTAAAACGTCTAGTTCTTCCGACTTTTTCCAACTCA
AAGCCACAAAACAGAACCCCAAAGCAGTTTCCAGTCTCCGAATCCCAGGATATAAAATCCTCCCCGCCCGCCCGCTAGGA
CCCTGGTCGCCTTAAAATAAAATCCATCCCCCTCCACACGGTTTTCCTTGCACCGAAGGCCAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26538959..26539185 227
 
EST/CDNA Est Name
  CJ138278.1 - BY188430.1 - BY181506.1

 
Come back to gene CJ138278.1 - BY188430.1 - BY181506.1


For any suggestions or comments, please send an email to unitrap@crg.es