Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14576B2
Clone ID IST14576B2
Vector VICTR74
Project tigm

Sequence tag IST14576B2HMR1
Sequence
CATTAAAACAACAACAACAAATTACAAACTGTAATATTCAAGCAGAAGACCAATATGTAAAAAATTGCTTAAGAAAAGCA
ATGAGAGACCAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448730..100448828 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST14576B2HMF1
Sequence
GTGTGTGTGTGTGTTTCCTTTTTCTTTGTTTCTTTTGTTCTGTTGTTTTGTTTTCCCTGTTTATATTCTAAAGAGAGAGA
GAAAAAGAAATCATGGAGTTGGATGACTGGGATAGTAGAGAGAATATGGGAGGAGAAACCATGAACAGAATATATCGTAT
AAAAATTATTTTCAAGCCGGGCAGTGGTGGCCCACTCCTTTGATCCCAGCACTTAGGAGGCAGAGGCAGGTGGATTTCTG
AGTTTGAAGCCNACCTTGTCTATAGAGTGAGTTCCAGGACAGCCAAGACTACACAGAGAAACCCTGTCTCAAAAAACAAA
CAAAAAAAATTATTTTTAGGCCGGGAAGTGGTGTCACATGCCTATAATCCTANCACTTGNAANACAGAGGCNGGTGGATT
TCTGANTTCNAGGCTAGCCTGGTCTACANANTTCCAAANCAGCNNNGGCCNCNTCANGGGGCANGCCCCACACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448829..100449303 439
 
EST/CDNA Est Name
  CX237052.1

 
Come back to gene CX237052.1


For any suggestions or comments, please send an email to unitrap@crg.es