Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14899C3
Clone ID IST14899C3
Vector VICTR76
Project tigm

Sequence tag IST14899C3HMF2
Sequence
AACTGATTCACCTAAGGTTAGGTTGGAACTGTAGCGGCTGGAACGGAGAACTCGCTCCCGGAACGTTTGTTTTGCAGCGC
CTGGCTTCCAGCCGGTGCTCTTTCGCGAAGGACCATTCCGGCCAAGTGCCTGTTGGTAGCAGCTTANTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 74224591..74224739 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021103 (Mnat1) NP_032638 menage a trois 1 Gene [Source:MGI Symbol;Acc:MGI:106207]


Sequence tag IST14899C3BBF1
Sequence
GGCAGCTTCCCCCCTCCTTTCACAGCCTGCCATGCTGTGCTGACCCCCAACCATACAATTATTTCACTGATACTTCGTAA
CTGTAATTTTGCTAGTGGTTTACACTGTAATGCATATATCCAGTATGTGAGCCTCCTAGGGTCGCGGTCCACAGGTTGAG
AATGCGAGTTTAGAGCATCTTATGTGCATGTGACCCTGTTACACAGTCTACAGTTTTTCTCATTACGGACATTTTAGAAA
CCGCCTTTTTCTTTCAGAGATTCCACTTANCTCTCTCCAATCCTCAACACCCCAAGCGCCAGATAACCAAGCTCACAACC
TGATCTGAGACTTTCTTTCCNCTCTTCTCCTTAAATCCCATAATCACTTCCNAATGTGCATGCNTGGCTGCNNNANGGTT
TCTCANANGCATAATTTCTATATTTGTCCTTCATGANCANATCACAGCTNCGACTTTCANTNNCNNGGCTGGAGANNNCT
CANCTGTTTANAGNCCACACTTGCAGGGGANAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14899C3HMR1
Sequence
GCCCAGAAGGACTCGGGAATCCCAGGACTTGGGAATCTGAAGTACACAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI15461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72593356..72593407 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es