Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14729E8
Clone ID IST14729E8
Vector VICTR76
Project tigm

Sequence tag IST14729E8BBF1
Sequence
GCCTCCAGACTGCTGAGATAATGCAAGTAAGGCTTTTTGCTTGTGTGTGTTATAGTACAATAAGGAGTTAGAAAGGTGGG
AGGGGGAAATGGCTCAGCAGTTAAGAGCACTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACCACATAGTG
GTTCACAACCATCCATAATGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 100291050..100291234 181
NO GENE  


Sequence tag IST14729E8HMF2
Sequence
GTGAGAGACCAAGATTTCTGGGTTAGCCTCCCCAGGGTCAATTATCCGATATTAGCTAGCTGGATACCATGGTAGGAGGG
CACAGGAAAACCCTACGCAGCAATCTTCTTGGTTCTGCTTCCTATTTAGGTGGCAGAGCCACAGCAATAGCTCTGGACTC
CTGCTTCCCTGTGTGTCCACAATCTACACTGTATAGGAAGATAGGCGCTTTGCTCAGAAGACTTCAGGCCACATGAGAGG
AGGAGCTGGACGCAAACCCCTCATTTGTTCTCTAGCGTACTTTCTGCTCGGTGGTTTGAAAGGATGCTTTTGAAGTTATA
TGGAACAAGTATGGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81341405..81341740 336
 
EST/CDNA Est Name
  AI787896.1 - DV049039.1 - AI425324.1 - AA518205.1 - DV063570.1 - BE625429.1 - BY333390.1 - BY296971.1 - BY022403.1 - BY137721.1 - W82966.1


Sequence tag IST14729E8HMR1
Sequence
TCACCCAGGGGCGAAAGTGGCCCTGCACTCCTACAGCCACCTGTCTCCTTTTGCAGGGTAGATTGTACTTTCAAAGCCAG
AGACTCAGTGCCCTTGCTAAATAAGGCTGGTGGCCTATGTCCAACTTGGCTCAAGGGTTCAGAAACCCTCCTCTGATGTG
CCATGTCTGGGCTCAGTCTTGTCTTGGTAGCCCTCTGTACATAATTCCATCCCANTCATGCAGCCTTTGTGAGATATGTC
NATACTGGTGTGTTTCTCTCTCTGGAGAGGAAGTGCCANGGACCCAAACCACGTCTTCCCTGCAATGGAGGCTTANTAAG
CCCTCCATGAAGTGTGAATTGCCCTCGGAAGAGGTGGATGTTC
Sequence Type genomic DNA
Unitrap ID UNI35014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81341047..81341408 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031683 (Lsm6) NM_030145 LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1925901]

 
Come back to gene ENSMUSG00000031683


For any suggestions or comments, please send an email to unitrap@crg.es