Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13417A8
Clone ID IST13417A8
Vector VICTR74
Project tigm

Sequence tag IST13417A8BBF1
Sequence
ATCTATCTATCTATCTACCTATCTATTTTTTATGGACTATTTTTTGTTTGTTTTTGTTTGTTGTTTTTTGTTGTTTTTTT
TTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114421276..114421363 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST13417A8HMF2
Sequence
GGATCAAATATCCCACAACCCTCGGTGTTTTGTTACTATCTAGCTAACTACTGTATATAATCACATATGATTTTATAATT
CTAAACAAGTGTGGGAGGCCGTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55795099..55795203 105
NO GENE  

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es