Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14488H3
Clone ID IST14488H3
Vector VICTR74
Project tigm

Sequence tag IST14488H3HMF1
Sequence
ATGGGAACCAGGCAAGCACTATACCACTGCGCTACATCTCCAGCTCTTAGTGTTTTAAGACCCGGTATCTTCATAGCCTA
GGCTGGACTCAAACTCACCACCCTCCTGCCTCCATCTCCCAGTGCTAGGAGTATAGGTGTGTACCCCCTGCAGTGGGGCC
TGATGTTGCATACTTTTAAATCTAAACTTTCTAAAGAAGGCTCTACGCTAAGAACCCGGCTTGTTTTCTGTAGCACAGCA
CCCGCCTTTTAAAATACTCATTTCTTTTTCCTGTTACCCAGCCACTCCTATAGTGTCTTTATCCTGGGGAGGN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56872074..56872385 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST14488H3BBF1
Sequence
ATGGGAACCAGGCAAGCACTATACCACTGCGCTACATCTCCAGCTCTTAGTGTTTTAAGACCCGGTATCTTCATAGCCTA
GGCTGGACTCAAACTCACCACCCTCCTGCCTCCATCTCCCAGTGCTAGGAGTATAGGTGTGTACCCCCTGCAGTGGGGCC
TGATGTTGCATACTTTTAAATCTAAACTTTCTAAAGAAGGCTCTACGCTAAGAACCCGGCTTGTTTTCTGTAGCACAGCA
CCCGCCTTTTAAAATACTCATTTCTTTTTCCTGTTACCCAGCCACTCCTATANTGTCTTTATCCTGGGGAGGGANGN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56872072..56872385 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es