Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14192B4
Clone ID IST14192B4
Vector VICTR74
Project tigm

Sequence tag IST14192B4HMF2
Sequence
TTTATTTTATTTTATTTTGGTTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGCAGACCA
GGCTGGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14192B4BBF1
Sequence
CCACCACTTTCCAATTCCACAGGGTAGAGTCCAAGACAGAGCACTCAGGAAAGCAGGACTTGGGGAGGGCAGGTCTGGGA
GGAAGCTGGGTTAAGCAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27371531..27371632 102
 
EST/CDNA Est Name
  W34871.1


Sequence tag IST14192B4HMR1
Sequence
TTGGTCTCCTTTGAGCCGGTTTCAGGTTGATGCTAGCCTCACATTTAACTGCTTTGAATTCCTGAGCCTCCTGAATGCTG
TGAGGCANATTGGCTAATGTTGATATTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTCCCCGTTTTTGTTTTTGT
TTTTTGGTTGGTTGTTTGGGGCCCACATCCTTANAGCTCTTCATCCTTANNGCTGGAATTAAAGTGGGTGGTGCTACAAC
TANTGTCTTCANATGTTAATATTTGTCTTCCTGAAANACCCAGCTTATTAACGATGTGATGGGCANGGCTGGGTGGTGGT
GTGCTTGTTGGCAAGGTCNTCCACCTGCTGTTANGTGAATCTCNTTATATGCTAAAAGAANCTNANTTCCNAGAGACTTC
CCACACTGGAGATNGATCTGCCCTACACTGTTGGCCTTTCATTN
Sequence Type genomic DNA
Unitrap ID UNI2641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27371630..27372071 410
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026917 (Wdr5) NP_543124 WD repeat domain 5 Gene [Source:MGI (curated);Acc:Wdr5-001]

 
Come back to gene ENSMUSG00000026917


For any suggestions or comments, please send an email to unitrap@crg.es