Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14666F5
Clone ID IST14666F5
Vector VICTR74
Project tigm

Sequence tag IST14666F5HMF1
Sequence
TTTGTTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCAAATCAGCACGTGTTCTCTCCCTTTCTGGGTGTTGGGAGCCAGCT
TTGATGAGTCAGGGTGTGGAGTCAGGGGAGTCTACAGACACCAAAGCTTCTTTCTAGGACAAACAGGTTCTCTCTTTACT
TTAGGGGGAAACACACGCACACGCACC
Sequence Type genomic DNA
Unitrap ID UNI30801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52730362..52730546 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]


Sequence tag IST14666F5BBF1
Sequence
TGTTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCAAATCANCACNTGTTCTCTCCCTTTCTGGGTGTTGGGAGCCAGCTTT
GATGAGTCAGGGTGTGGAGTCAGGGGAGTCTACAGACACCAAAGCTTCTTTCTAGGACAAACAGGTTCTCTCTTTACTTT
AGGGGGAAACAN
Sequence Type genomic DNA
Unitrap ID UNI30801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52730375..52730545 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]

 
Come back to gene ENSMUSG00000011382


For any suggestions or comments, please send an email to unitrap@crg.es