Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0691
Clone ID AL0691
Vector pGT0lxr
Project sanger

Sequence tag AL0691
Sequence
AGTTTTTTGAGACAGGTTTTCTCTACCTCCCTCACGACTATAACCGCTTAATGCCTAGTCTCTTTCCTCTATCTCCTTCC
CCTCTCCCGGCCGGTCGGGCGGGGCGGGCGGCTGACAGCGTCCTGAGGTTAGCATTATACTTTTCCAGTGGAGCCCATGA
CTTCTGATCAGGACGCTAAAGTTGTGGCTGAACCGCAGGCACAGCGAGTCCAGGAGGGCAAGGACAGCTCTCATCTGATG
AATGGTCCTATATCGCAAACCACTTCTCAAACAAGGTCCCTCCCAGCTTTGACTCAGC
Sequence Type mRNA
Unitrap ID UNI2656

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8785339..9123208 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es