Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14732F4
Clone ID IST14732F4
Vector VICTR76
Project tigm

Sequence tag IST14732F4HMR1
Sequence
AACTCTCGGGAAAGCTTCCTAGATGGGGTTGCGGCCGGTGGTGATGAGAGGGGTGGTGACTCGGCGTTGGCTGCTGGGCT
CGGTGGTGATGGTGATGATGATGGTGGTGATGGTGATGGTGGTGGTNNGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17968847..17968972 126
NO GENE  


Sequence tag IST14732F4HMF1
Sequence
AGCANCGACTCCGAGTCCAGCTCCTACTCCGACCATGCAGCCAATGACTCGGATTTTGGCTCCAGTTTGTCCAGCTCCAG
CAACTCGGTGTCCTCAGAGGAAGAGGAGGAGGAAGGAGAGGAGGAGGAGGAAGAGGAGGAGGAGGAAGAGGGGGGCAGCG
GGGCCTCGGATTCCAGTGAAATCAGCTCGGAGGAGGAGGATTCTTCCACCGAGTCANACTCCAGCTCCGGGTCCAGCCNA
NTGTCNNTGCAGAGCANCCGTTTCAGGCGCACCAA
Sequence Type genomic DNA
Unitrap ID UNI33165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17968571..17968844 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054074 (2810030E01Rik) RIKEN cDNA 2810030E01 gene Gene [Source:MGI Symbol;Acc:MGI:1919918]

 
Come back to gene ENSMUSG00000054074


For any suggestions or comments, please send an email to unitrap@crg.es