Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14525G1
Clone ID IST14525G1
Vector VICTR74
Project tigm

Sequence tag IST14525G1HMF1
Sequence
ATATCAAGAGGAAAGCAAGGTCATTGCCCTGGGGAGCAGCAGACCAGGATCAAGGCTACCTGAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177019555..177019620 66
NO GENE  


Sequence tag IST14525G1HMR1
Sequence
ATATAAATTCCTAAATTCTTGANTTAAAGAGTGTAGCAAAGTAGTGTTTTATAATAGCTCATTTGAGTCAAATAATGAAC
TGTTCATTTCTTCCACCTTCAGTANAGAACAAGAGCAATGGTTTACTGTTATCTCTGTCAGGTGAAGTAGGGCAGGAGAT
GGCTAGATTATAGACGAAAGCTTATGGATATCTGCTCCAGGTGTCACCACTCTAGTGAAGGATAAGTGTCAGGCAGGGTG
AATAATTTTGTAATTTAACAGCATGTATTAAATAATGCATGTGATTAAATAAAACTANATTGGTGGGTTCTTAATTTGTG
CAGGTTANCTTGANCCNNTGATAATGAATTTCTGTTTTAGGATCTGTACTATATAGATATAATGTATCNNAAATGTAAAA
CACATGCCATTANCTGGAGCTGTGTGTGTCANATN
Sequence Type genomic DNA
Unitrap ID UNI4932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176867082..176867515 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es