Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14160F11
Clone ID IST14160F11
Vector VICTR74
Project tigm

Sequence tag IST14160F11HMR1
Sequence
GGCTGTCTTCNCACACATCANAAGAGGGCATTGGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGAGAACT
GAACTCAGGACCTCTGGAAGAGCAGCCAGTGCTCTTAACCGCTGAGCCATCTCTCCAGCCCAANAGATACTAACACTTAT
CAAATTCTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI20563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34598944..34599120 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026867 (Gapvd1) NM_025709 GTPase activating protein and VPS9 domains 1 Gene [Source:MGI (curated);Acc:Gapvd1-001]

 
Come back to gene ENSMUSG00000026867


For any suggestions or comments, please send an email to unitrap@crg.es