Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14499B5
Clone ID IST14499B5
Vector VICTR74
Project tigm

Sequence tag IST14499B5HMF1
Sequence
GAGTTCACACCTTCCTTCAGGTTCTTGCCCTACCTGAATTCCTTCCCTGGCTTTCCGAAGTGATCTACTGTGATTAGGAC
AC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97004389..97004469 81
NO GENE  


Sequence tag IST14499B5BBF1
Sequence
NNNNNNACACCTTCCTTCAGGTTCTTGCCCTACCTGAATTCCTTCCCTGGCTTTCCGAAGTGATCTACTGTGATTAGGAC
AGGTTAAGTCAAACAAACCCTTGCTTGCCCTAGCTGCTTTTGGTCATGCATTTATCATACAACAGAAAGCAAACTAGGAC
AAAAGCCAAATGTGAAAATTAGCAACATATGAAGTATTTGGAGCTGAATGCATTTCCNCTATGCAAAAACATTTAATATG
TTTATGTCCACAAGTAAATACCCAACGAGAATCTTTCCAGAAGCAGCCAGTATTTGTGACAGANATCTTACTTTCTAAAG
GGAATACAGCTGGGATAAGGCTCCTGATAGTATTTGTCTAGCATGTATTGAGCCCTAATTTCNCAGCACCCACGAANGTN
CCCACTCACCCACGCTCCTGGGCNGNANCTGAATTCCCTGANGAGCTCAAAAACCTGAGTTCAAATTTAAGAAAANGCNC
TGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97004395..97004871 455
 
EST/CDNA Est Name
  BU516517.1 - BI663713.1 - BB624380.1 - BB661506.1 - CN703639.1 - BB658741.1 - BB858590.1 - CJ065342.1 - BY018951.1 - BY766629.1 - BY013506.1 - BY173463.1 - BY303870.1 - BY009822.1 - BY016748.1 - BY143963.1 - BY032315.1 - BY060654.1 - BY015665.1 - BY015241


Sequence tag IST14499B5HMR1
Sequence
CTNAAGCAGAGGCCATGGAACACTGTTTACATTGCTTACTGTCCATAGGCTACTGATTTTGCTTTTCTAAACAACCCAAA
ACCATCTGCTCAGGGGTGGCACCACCCACCATGGGCTAGACCCTCCCACATCAGTCATTATCAAGAAAATGCCTCTACTT
GCCCAGACATGCCCAGAGGGCAAGCTGTTGAAGGCGTTTTCCCATAAAGGTTCTCTCTTCCTATATAACTCTANTATCAN
ATTGACAAAAGACTAACTANCATANCTTTTTAAAGATTTGTATTCTTGAGAGTTTCATACNTGTGCANTGAAATATATTT
ACTACTAATAAACCTCCCTCCAACACCCCCATATTCCTCTCANTACAGTCCCCTAATTTCATGCATGCACACNCNCACCC
NATCTANTTGGGGCTACCTTTCTGTGCATGGGTGTTGGACCATCCACTGGANTGTGNAAATTGTTCCAGTANCCACANCA
NTCAANTTTTAAATGTAATTTTCCTTACTCNNNCNNCTGTN
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003882..97004391 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es