Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10497F3
Clone ID IST10497F3
Vector VICTR76
Project tigm

Sequence tag IST10497F3BBF1
Sequence
GCTTTGCCTGCCTCCANNGCGCTAGGATGCAAGGAACAGTCCCCTTTTGTTGTTTTTTGTTTTCTTGAAACTGTTTTATA
TATCCTANACTGGCCTTGACTTAAGTAGCTGTGAATGACCTTGAATTTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI34250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115886724..115886857 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016559 (H3f3b) NM_008211 H3 histone, family 3B Gene [Source:MGI (curated);Acc:H3f3b-001]

 
Come back to gene ENSMUSG00000016559


For any suggestions or comments, please send an email to unitrap@crg.es