Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST10515-NR
Clone ID PST10515-NR
Vector U3NeoSV1
Project escells

Sequence tag PST10515-NR
Sequence
GCTTAAGGTCCTGCAGTTTTAAAACAGTTCCCCGGATTTCCTTCATACGTATGTCTCCGGTGAGTTCCTCTGCAGTCCTT
CCCAGCCTGACTTCTGAATAGAACAGCAGCGAAGCTCACTGCCTTGGCACCAGGGTGAGGAGCCCGCAGTGACGTTTAAG
TAGCCTTCCAAAGGTGTCACCCGATGGCGATTTTCCCATTTCTCTTTAGATTCTTCACTGCACTTGTTACTCCAGACTGC
AGTCACTCCCCTTCCTCATCTCCCATACT
Sequence Type genomic DNA
Unitrap ID UNI14887

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74332123..74332391 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026179 (Pnkd) NM_019999 paroxysmal nonkinesiogenic dyskinesia Gene [Source:MGI (curated);Acc:Pnkd-001]

 
Come back to gene ENSMUSG00000026179


For any suggestions or comments, please send an email to unitrap@crg.es