Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0417
Clone ID GC0417
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0417
Sequence
CTGCAGACACCAGAAGCCCTCCTGAGGGGAAAAGCAGGACACTCTCCACTGGCTGCCCATGCTCCACACAGAGAACATTC
TATCCTCCCCCACCATCCAATATCTTCACAGTATGATCGTATGATCCTGTTACAAAAAGGTCTGGGTTCAGTTTGCTGGC
ACAGCCGCACCTCACGTAATCAGAATGTTCTTTGAATGTCAGGATTTCTTTAGAGTTTGGAATATCCCATAATTTAACAG
TATAGTCATCAGCTCCAGAGACCACATGATAATTGTCATCTGTAAAATCTACTGTATGAACTGCTTTTGTGTGGCCTTCA
AACTGCCTGAGGGGAGCCCTCCCATTTATATCAAAAAGTTGAACTACACCATCTTCACTGCCAGCAACGAGCAACTGACC
ATCCTGTCGAAAAGTCGCACAATATGCTGTGTCCTTAAAACGGGAAAAGGTTTTTACAGGCTCTTGAGAGTACCGGCCAT
AAATGTGGATT
Sequence Type mRNA
Unitrap ID UNI259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99027056..99029244 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041747 (Utp15) NM_178918 UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2145443]

 
Come back to gene ENSMUSG00000041747


For any suggestions or comments, please send an email to unitrap@crg.es